Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0287
Clone ID XP0287
Vector pGT0lxf
Project sanger

Sequence tag XP0287
Sequence
AATGTAGTCACTGCTGCGCAAGCCAAGAACCTCATAGATGCAGGTGTAGATGCTTTGCGAGTCGGCATGGGAAGTGGTTC
CATCTGCATCACCCAGGAAGTGTTGGCCTGTGGGCGGCCCCAAGCCACAGCAGTGTACAAGGTCTCTGAGTATGCCCGTC
GCTTTGGTGTTCCTGTTATTGCTGATGGAGGAATCCAAAATGTGGGTCATATTGCCAAAGCTTTGGCTCTTGGGGCTTCC
ACAGTCATGATGGGCTCCCTCCTGGCTGCCACCACTGAGGCCCCTGGCGAGTACTTCTTCTCAGATGGGATCCGGCTGAA
GAAATACCGAGGTATGGGTTCTCTTGATGCCATGGACAAACATCTCAGCAGCCAG
Sequence Type mRNA
Unitrap ID UNI3791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108465926..108467327 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062867 (Impdh2) NM_011830 inosine 5'-phosphate dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:109367]

 
Come back to gene ENSMUSG00000062867


For any suggestions or comments, please send an email to unitrap@crg.es