Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST380469
Clone ID OST380469
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST380469
Sequence
ACCACTATCCCAGTCCCCTAGTACATCCCTGAAGAGCTGTTCTAAGTGCCAATACAAGAGCTGTTATGTGTATGAATATC
AGAGTAAGTAAAAGGAGTCAAGTTACACTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100429334..100429443 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es