Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST379707
Clone ID OST379707
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST379707
Sequence
GACTGAGGCACACACTGATAAAGAAGCTCTGCCAGCTGAGGGAGAGCGAGCCGGAGCTGGCCCAGCTGCTCGTGGATCAG
ATCTATGAGAATGCCATGATAGCAGCAGGACTCGTTGATGACCCCCGGGCCATGGTCGGCCGCCTGAACGACCTTTTGGT
CAAGGTCCTGGAGAAACACTGACAGCCAAGACACTGGATTTAGTGTCAACCCAGGTCTTCTCGGGTGATAATGGACCTGC
CTGGGGAGGCAGGACTTAATACACAAACAGTGCCACCAACTGCTTGAGCTCAGCTTTATTTACTTCAATTAAACAGTATT
TCTTAGT
Sequence Type mRNA
Unitrap ID UNI11119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4039978..4040433 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005981 (Trap1) NM_026508 TNF receptor-associated protein 1 Gene [Source:MGI (curated);Acc:Trap1-001]

 
Come back to gene ENSMUSG00000005981


For any suggestions or comments, please send an email to unitrap@crg.es