Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0044
Clone ID XP0044
Vector pGT0lxf
Project sanger

Sequence tag XP0044
Sequence
TGCGATCCGGAGAAGCCGGGGTCTGAGCGGCTCCTCCAGAGTTCNTGATCTATGAAATGGCAGAGAATGGAAAAAATTGT
GACCAGAGACGCATAGCAATGAGTAAGGATCAGCACAATGGAAGTCTCACAGACCCCTCTTCAGTTCATGAGAAGAAGAG
AAGGGATCGGGAAGAAAGACAGAATATTGTCCTGTGGAGACAGCCACTCATTACCTTGCAGTATTTCTCTCTGGAAACTC
TTGTAGTTTTGAAGGAATGGACCTCAAAATTGTGGCATCGTCAAAGCATTGTGGTGTCCTTTTTACTGCTGCTTGCTGCG
CTAGTAGCTACGTATTATGTGGAAGGAGCGCACCAACAGTTGGTGCAGAGCTTTTAGAAACAGTTTTTTTTGTATGCATA
CTGGATAGGCCTGGGGATTTTGTCCTCTGTTGGTCTTGGAACAGGACTGCACACCTTTCTGCATTATCTG
Sequence Type mRNA
Unitrap ID UNI3803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86474625..86497271 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es