Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST379345
Clone ID OST379345
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST379345
Sequence
TGAGCTTCAGTGTTTCTGCCCCTCTGTNCAAAGGATANTTTTACCTGTGAGACAGATGGTCTTTGCTTTGTCTCAGTCAC
TGAGACCACAGACAAAGTTATACACAATAGTATGTGTATAGCTGAAATTGACCTAATTCCTCGAGACAGGCCATTTGTAT
GTGCACCATCTTCAAAAACAGGGGCAGTTACTACAACATATTGCTGCAATCAGGACCACTGCAATAAAATAGAACTCCCA
ACTACAGGTAAGTTGTTGCATTAGCACCCTTCCCTTTCTTCTTCTAAGATGCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47396626..47396923 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007613 (Tgfbr1) NM_009370 transforming growth factor, beta receptor I Gene [Source:MGI (curated);Acc:Tgfbr1-001]

 
Come back to gene ENSMUSG00000007613


For any suggestions or comments, please send an email to unitrap@crg.es