Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST379311
Clone ID OST379311
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST379311
Sequence
GAGGACACAGACCTTGCTGACGGAAGGCAGNCCCTCTCCATCTCACCTGCCCTCCAACTGCCTGAGCTACCCACTCCTCC
TTCTCCGGGGGACCCTGCAGCTCCCCGGTGGTGTGCATTGGAATGGACTTCGGACCTTGGACTCTTGGGATGCAAAGGAT
GAAGTGACCCCCACCCCCAACTGTGTTTGAGGAATCTCTAGGACCCCGTGAGAGTTTGGGACCAAGGAGCGGAGAATGGA
TCTTGGAACAGCGCAGCTGCCGACCTCTATTGAGGGACAAACATAATCAGCACTGACGCAAATTAGATGGTTATTCGTTT
TGAAAATTGACAGAAAAACAAAAA
Sequence Type mRNA
Unitrap ID UNI17447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148212377..148296043 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es