Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0167
Clone ID CD0167
Vector pGT0lxfT2
Project sanger

Sequence tag CD0167
Sequence
CAGTCGTTCGACAACATGAGGAATTTATCTGGCTTCATGATTCCTTTGTTGAAAATGAAGACTATGCAGGTTACATT
Sequence Type mRNA
Unitrap ID UNI3748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55884390..55884466 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005656 (Snx6) NM_026998 sorting nexin 6 Gene [Source:MGI Symbol;Acc:MGI:1919433]

 
Come back to gene ENSMUSG00000005656


For any suggestions or comments, please send an email to unitrap@crg.es