Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST378965
Clone ID OST378965
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST378965
Sequence
GCTCAGAGGGGCCTCCTAACCCTNGGNCAGATCCAGAGNGCTGCAGCATNCTGCATGGNCTTGNTGCAGCANAGGAAACC
CTTTGCAAGATTACCGANTACCANCATGAGGCTCGCACTTTACTCATGGNAGAATGCAGAACAGAGTTGGGAATAGAGGA
CGGATAATCTGCATCACAAATGCAAAAAGTGATAGTCATGTCCGAATGCTCGAAGATTGTGTCCAGGAAACAATTCATGA
GCATAACAAGCTTGCTGCAAATTCAGATCATCTCATGCAGATTCAAAAATGTGAGTTGGTCTTGATTCACACCTACCCAG
TTGGTGAAGATAGCCTTGTGTCTGACCGTCCTAAAAAAGAAGTAAGTATGGAAGTACTGCAGGAAGAGATGGTTGTGAGT
TCAAATTAAGCAATGCTGAGAATGATAGCATTAAACTGATCACATTGCTGTTTTTTTTCTGCCAAGAAACTATGTGAATG
TCTGAGAACAAACCT
Sequence Type mRNA
Unitrap ID UNI19845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146511816..146515198 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040250 (4933424B01Rik) NM_138757 RIKEN cDNA 4933424B01 gene Gene [Source:MGI Symbol;Acc:MGI:1918427]

 
Come back to gene ENSMUSG00000040250


For any suggestions or comments, please send an email to unitrap@crg.es