Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0145
Clone ID CD0145
Vector pGT0lxfT2
Project sanger

Sequence tag CD0145
Sequence
ACAAGCAGCAAGCCAACACCATCTTCTGGAGTCCCCAGGGGCAGTTCGTGGTGCTGGCCGGGCTGAGGAGCATGAACGGT
GCCTTGGCGTTTGTCGACACTTCAGACTGCACCGTCATGAACATTGCAGAGCACTACATGGCCTCCGATGTTGAATGGGA
CCCAACTGGCCGCTACGTGGTTACCTCTGTGTCGTGGTGGAGCCACAAGGTGGACAATGCTTACTGGCTGTGGACCTTCC
AAGGTCGCCTTCTGCAGAAGAACAACAAGGACCGCTTCTGCCAGCTGCTCTGGAGACCAAGGCCCCCAACACTCCTCAGC
CAGGATCAGATAAAG
Sequence Type mRNA
Unitrap ID UNI3810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140914279..140917065 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056076 (Eif3b) NM_133916 eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]

 
Come back to gene ENSMUSG00000056076


For any suggestions or comments, please send an email to unitrap@crg.es