Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST378731
Clone ID OST378731
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST378731
Sequence
ACTGAGCTGGGGCTTTTTGTGGAGTTCAACCCTGNGGACATGCTCCTGGGGGTGGATGAGACTGAAGATGATGGAGACCT
GGAGGCTGAGTTACTGGCACTCACAGGGGAAACAGCGAGCAGGAGCAGGAAGCCAGCACCCAAGGGGCAGGCTCCACTGC
CCATGGCCCACATTGAGAAGCTGGCAGCAGACTGTATGCGAGATGTGGAGGAGGATGAAGAAGAGGAAGGGAAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI19856

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108296051..108297128 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028582 (Cc2d1b) NM_177045 coiled-coil and C2 domain containing 1B Gene [Source:MGI (curated);Acc:Cc2d1b-001]

 
Come back to gene ENSMUSG00000028582


For any suggestions or comments, please send an email to unitrap@crg.es