Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST378428
Clone ID OST378428
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST378428
Sequence
TCCTCTGATGAAGTTGTTTCTGCAACTTTTAATGATCTTAATAAAGAATACTTTAAGAACCATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19868

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 94418283..94418339 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045414 (1190002N15Rik) NM_001033145 RIKEN cDNA 1190002N15 gene Gene [Source:MGI Symbol;Acc:MGI:1916111]

 
Come back to gene ENSMUSG00000045414


For any suggestions or comments, please send an email to unitrap@crg.es