Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0181
Clone ID CA0181
Vector pGT0lxf*
Project sanger

Sequence tag CA0181
Sequence
TATCTTTTATTTACTTGGGAATGTAAGATGTTCCATTTTCACACCAGCATGGTAGTATTGAGATAGCTATTTGTCTAAAC
ACGCTGATGTTTGGGGGTAAGCTTCTGTTGGGGGGTTTTTTTTTTTTTTTCTGCTTTTTGGCACATAAATTGGCTATTTC
TTCTGGAGTGGATAAGTACAACAGTGACAAATACATGGAACAGTAAAGAAGACCTTGCTCTTAAATCCAAGGAACCTGGC
TAACTCTGGATCTGACCATATGAAAACTTCAAAGTAAATATGGGTAGCTGACTTCAAGTAACTCTATGTCAAATAGTCAT
AGGTTAAGTATCTTCAAAGAACTTGGATATTTCAGTGGATACAAAATAAAAAAACAAACTGGAAAACATAAAGCTTATAG
AGAAGAAATCAACACCTTCTTGTGCAGTCCTTTTGGAATTT
Sequence Type mRNA
Unitrap ID UNI699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112277631..112278071 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es