Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST378359
Clone ID OST378359
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST378359
Sequence
AAATGGGTGATAGACCAGNCTTGTCGGAAGTGGAGAGATTCGATAAATCCAANCTGAAGAAAACCATCACCGAAGTAAAA
AATACTCTGCCCTCGAAGGAAACCATCGAGCAAGAGAAGGAGTTTGTGAAAAGATCATAATGAGGATCTTTTCCAACAAA
TAAATGCCAACACGTGGCAAGCAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 132253213..132254306 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060726 (1700129I15Rik) NM_030106 RIKEN cDNA 1700129I15 gene Gene [Source:MGI Symbol;Acc:MGI:1925728]

 
Come back to gene ENSMUSG00000060726


For any suggestions or comments, please send an email to unitrap@crg.es