Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0083
Clone ID AZ0083
Vector pGT0lxr
Project sanger

Sequence tag AZ0083
Sequence
TTTTTTTTTTTTTTAGAAGTCATTGAAGAGGCAACCCAGAATCTGCTGACAATGCTTGGTTGGGAGCTTTTTTAAATGGT
TTTTTTTTTATTAGTCTCGGCGCGCAGCTCCCGGCGGCAAGGCTGCCCAGCGAGGACTCACTGTCCAGTGCTTCTACTTC
TCATTCAGAGAACTCGGTGCATACCAAATCAGCTTGTGCTATATCATCAGAAGGCATTTCAACCTCTGCACCCATTCTCC
TCCATGACAACCAGGT
Sequence Type mRNA
Unitrap ID UNI3822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13553789..13586820 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031918 (Mtmr2) NP_076347 myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]

 
Come back to gene ENSMUSG00000031918


For any suggestions or comments, please send an email to unitrap@crg.es