Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST377878
Clone ID OST377878
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST377878
Sequence
GTAAAACTACTTGTGAAAAATTGTATCTGNCAGAATTAGCAAGACTTGGAGTTAATAACAAATTTGTCAAATTCAACAAA
TTGAAGTTTAACACTGTAAGAATTACAGTTACCTGAACAGAAATNGGGACAGACTNCTTANACTTGGAGGAGGCNTGCCT
GGGCTGGGCCAGGNCCCACCTACAGATGCTCCTGCCGNGGACACAGCANANCANGNTNTATATCTCTTGCTTGNNCTTGN
TAAAGATGAGTGAACATG
Sequence Type mRNA
Unitrap ID UNI11980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61558512..61598769 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026914 (Psmd14) NM_021526 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI (curated);Acc:Psmd14-001]

 
Come back to gene ENSMUSG00000026914


For any suggestions or comments, please send an email to unitrap@crg.es