Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST377865
Clone ID OST377865
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST377865
Sequence
AGTTCTGCTGGAACAAGCGGGTGCTGATGCAACTGAAAGCTTTGAAGATGTCGGCCACTCCCCTGATGCCAGGGAGATGC
TAAAGCAGTACTACATTGGAGATGTCCATCCGAGTGACCTTAAACCTAAAGGCGATGACAAGGATCCTTCCAAGAACAAT
TCATGCCAAAGTTCCTGGGCGTATTGGTTTGNCCCCATCGTGGGCGCTATTCTTATAGGTTTCTTGTATCGNCACTTCTG
GGCTGACAGCAAATCCTCCTGAGGAGACCTNCGTTGAAGTGCGGAGCACGTGCTCCTGCGATGAGAGGAGGAGACTTGTG
NGGAGGCTGNAGGGTGTTCCCTCCTTGGAACNTGCCANNTGTTTTCTTTCCCCTTGGAGCCAA
Sequence Type mRNA
Unitrap ID UNI19893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109693729..109707688 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031924 (Cyb5b) NM_025558 cytochrome b5 type B Gene [Source:MGI Symbol;Acc:MGI:1913677]

 
Come back to gene ENSMUSG00000031924


For any suggestions or comments, please send an email to unitrap@crg.es