Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0494
Clone ID AX0494
Vector pGT0lxr
Project sanger

Sequence tag AX0494
Sequence
CTAGATGGTTTTTTTTATTTTTTTCTGTGACCACTGTCAATCTCTTGTCGTACTTAGTAGTGAAACCGAATGTGTCCTCT
AAAAGAAGTTCATTGTCACATAAGGTAACGCGAGCTTTGAAATGCTGTGTCTGCTTCCTTATGTCTTGTTTTCTCCTTCA
CATCATTTTTGTTCTATATGGAGCACCACTAATCGAGTTGGTGCTGGAAACGTTTTTATTTGCAGTTGTTTTGTCTACTT
TTACTACAGTACCTTGTCTCTGTTTGTTAGGACCAAACCTCAAAGCATGGCTGAGAGTTTTCAGTAGAAATGGAGTTACA
TCTATTTGGGAGAATAGTCTTCAGATCACTACAATTTCTAGTTTCACAGGAGCGTGGCTTGGAGCATTTCCTATTCCACT
GGATTGGGAAAGA
Sequence Type mRNA
Unitrap ID UNI3240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87408152..87423086 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024145 (Pigf) NM_008838 phosphatidylinositol glycan anchor biosynthesis, class F Gene [Source:MGI (curated);Acc:Pigf-001]

 
Come back to gene ENSMUSG00000024145


For any suggestions or comments, please send an email to unitrap@crg.es