Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST377271
Clone ID OST377271
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST377271
Sequence
GCCCGGATGGCAGCAGTAGTTCTAGGGGGAGCCACCATGGGCCCTGAGCGTATCTTCCCTAATCAGACTGAGGACTTAGG
GCCACATCAGGGTCCTACAGAAGGAACTGGGGATTGGAGCAGTGAAGAACCCGAGGAAGAGCAGGAGGAAACAGGAGCAG
GCCCAGCAGGCTACTCGTACCAGCCCCTCAATCAAGACCCTGAACAAGAAGAGGTGGAATTGGCACCAGTGGGTGAAGGA
GAAGATGGAGCTGCTGACATCCAAGATCGGATCCAGGCCCTGGGGCTTCATCTGCCAGACCCTCCATTGGAGAGTGAGGA
TGAAGATGAGGAGGGAGNCGCCGCATTGAGCAGCCACAGCTCTATCCCCATGGACCCAGAACATGTAGAGCTGGTGAAAA
GGACGATNNCTGGAGTAAGCCCTGCCTGCACCAGGGGTTCCTGCCTGGGCTCGGGAGATCTCGGACGCTCAGTGGGAAGA
TGTGGTACAGAAAGCCCT
Sequence Type mRNA
Unitrap ID UNI18737

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46818571..46819785 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002768 (Mea1) NP_034917 male enhanced antigen 1 Gene [Source:MGI Symbol;Acc:MGI:96957]

 
Come back to gene ENSMUSG00000002768


For any suggestions or comments, please send an email to unitrap@crg.es