Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST377159
Clone ID OST377159
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST377159
Sequence
GACTGAGGAGAGGGAAGAATTAAATATTATGAGTACTTCTGGNTTAGAGACCTTGTGGATCTGAAAAAAATAAATCGTTG
GGTTCTTGTTAA
Sequence Type mRNA
Unitrap ID UNI17055

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23459990..23460076 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046351 (Zfp322a) NP_766174 zinc finger protein 322a Gene [Source:MGI (curated);Acc:Zfp322a-003]

 
Come back to gene ENSMUSG00000046351


For any suggestions or comments, please send an email to unitrap@crg.es