Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376848
Clone ID OST376848
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376848
Sequence
GACTGAGGTTTCCCAGTTCGTGGCGTTTGAGGAGCTTCCTGCAGGAGCCCCAGAGCTCCCCCAAGATGGCCCCACTCGAC
GCCTCTCCCTGCCCGGCCAGCTGGGGGCCCTTACCTCCCAGCCCCTGCACAGACATGGCTCAGATCCAGGCAGTTAGTGA
TGCTGCCCACTGTGGACATGTGGCTCACCCTGGGTTCAGGGCATTACCTGACCGCTCTCCTTGGAGACCCTGGTTTGGAG
GGGAGACCTGTGCAGAAGCACCTCCATCCCCACCCTTGGGACCAGCATCTCCTCCTGCAATACCCTGGGCCCCACTGGGA
GGGGCAGGACAGAGCTGGGCAGTGGATGGGGGGTCTGTGGTCCCCCCACTGCCCTGGGGGCATTAGCTGGTCTAACTGCC
CGGAGGCACCGGCCCTGGGCCTTAGGCACCTCAAGGACTTTTCTGCTATTTACTGCTCTTATTGTTAAGGATAATAATTA
AGGATCATATGAATAATTAATGAAGATGCTGATGACTATGAATAATAAATAATTATCCTGATCTC
Sequence Type mRNA
Unitrap ID UNI18751

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23825435..23825969 532
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038319 (Kcnh2) NM_013569 potassium voltage-gated channel, subfamily H (eag-related), member 2 Gene [Source:MGI (curated);Acc:Kcnh2-001]

 
Come back to gene ENSMUSG00000038319


For any suggestions or comments, please send an email to unitrap@crg.es