Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376811
Clone ID OST376811
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376811
Sequence
ACTGAGGATGCAGTGACTTTTGATGATGTGCATGTGAACTTCACTGGGGAAGAGTGGAATTTGCTGGATCCTTCCCAGAA
GAGTCTCTACAAAGATGTGATGTTGGAGACCTACTGGAACCTCACTGTTATAGGCTACACTTGGGAAAACCATCATATTG
AAAGACATTGTCAAAGTTCAAGAAGAAATGAAAGGTATGTAAGTAATCATAGTGGAGAGAAACTCTATGAATGTAATGAA
CGTTCTAAAGCCTTTTCATGTCCCAGTCATCTCCAAAGTAATATAAGAAGACAAATTGGAGAGAAAACACATGAACATAA
CCAATGTGGTAAAGCCTTTCCAACACCCAGTCATCTTCAATATCATGAAAGAACCCATACTGGAGAGAAACCCTATGAAT
GTCATCAATGTGGTAAAGCTTTTAGAAGTCACAGTGGTCTCCAATATCATAAAAGAACACATACTGGAGAGAAACCCTAT
GAATGTAATCAATGTGGTAAAGCCTTTGCACAACTCAGTATTCTCCAACGTCAT
Sequence Type mRNA
Unitrap ID UNI2455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17907464..18878437 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079167 (CT030170.10)  

 
Come back to gene ENSMUSG00000079167


For any suggestions or comments, please send an email to unitrap@crg.es