Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376780
Clone ID OST376780
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376780
Sequence
TGAGGACCCTGGCCATGGACCATCCCCCTGGCCTGCAGGTGGACTACATCTTCCGGGGTGTGGAGCACGCTGTGCGGGTT
GTGGTTTCTGGGCAGGTGCTGGAGCTGGAGGTGGAGGACCGGATGACAGCTGACCAATGGCGTGGAGAGTTTGATGCCAA
CTTCATTGAAGACTTGACTCATAAGACGGGGAACTTTAAACAGTTCAGCATTTTCTGTAACATGCTGGAGTCGGCCCTCA
CCCAGAGCAGTGAGTCTGTCACCTTGGACCTGCTCACCTACACAGACCTGGAGTCTCTGCGCAGCCGCAAGCTGGGAGGC
CGCCCAGGTGCCTTGGCCCCCAGGTCGGCCCAGCTCAACTCCAAACGCTACCTCATTCTCATCTATTCGGA
Sequence Type mRNA
Unitrap ID UNI19933

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19486281..19489290 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074358 (Ccdc61) NM_001033314 coiled-coil domain containing 61 Gene [Source:MGI (curated);Acc:Ccdc61-001]

 
Come back to gene ENSMUSG00000074358


For any suggestions or comments, please send an email to unitrap@crg.es