Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0171
Clone ID AX0171
Vector pGT0lxr
Project sanger

Sequence tag AX0171
Sequence
ATGCTTGGCACTTGTACAGGGCAGCTGAAGCTCTACAATGTGTTTAGTGGACAGGAAGAGGCCAGCTATAACTGTCACAA
CTCAGCCATCACACACCTTGAACCGTCAAGGGATGGGTCCTTACTTCTGACATCTGCCACTTGGAGCCAGCCTTTGTCTG
CACTTTGGGGAATGAAATCAGTATTTGATATGAAGCATTCCTTCACAGAAGATCACTATGTTGAGTTCAGTAAGCACTCT
CAGGATCGGGTCATAGGCACAAAAGGAGACATTGCCCAT
Sequence Type mRNA
Unitrap ID UNI3847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106762000..106763383 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es