Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376535
Clone ID OST376535
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376535
Sequence
CGTGTTGGGATGTTGGCTGTGTTCTTGAAGGTGGTTCGCACAGAAAGTCTCCTGGGCCTTTGGAAAGGGATGTCTCCTGA
CCCACCTTGCCGGAAGNCCCAAGGCATTGGTTTCCACCCTCCCCACAGCAGCCTCCAGCCATTAGAAGATGGAAAGTGAT
GTTTAAACTACACCCTTACCTNATANGCTNAGATCCNGGANTACCTNTTTGGAGANGGAGNCTTTTTNTGCCCATCTCCT
TTGGCACGAAAACCTATTAGAG
Sequence Type mRNA
Unitrap ID UNI19955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120026578..120029103 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032519 (Slc25a38) NM_144793 solute carrier family 25, member 38 Gene [Source:MGI Symbol;Acc:MGI:2384782]

 
Come back to gene ENSMUSG00000032519


For any suggestions or comments, please send an email to unitrap@crg.es