Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376359
Clone ID OST376359
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376359
Sequence
GACTGAGAGACAAAAGACTGTTGAAAATGCTGAAGGCTGTGCTGAAGAAGAGCCGAGAGGGAGGAAAGGGAAGCAAGAAG
GAAGCAGANTNATTGTTGGACTNNCNNNANCCTNNNTNCNGTNAACCCATTTCNTGNCTCATTCCTGNGANATCAGGCCA
GTCACACACACANCNAGGTATANGNGGCACGTCCGTTNGTCTCGACTCAGTNGATNGTGCTGTCCCAGNNTTGCCACCAC
TCACCCANGCACNACTGTTACATGTGACTCTTTTCGTCTGACANGTGGTTGTGCATCCTTGTTTTGCCGGTTNCTGNCAT
ACAGGTATATAAAACATTGTGTATACGTGGCCTNGCATTCNATATGGCCAGNGAGGNAGTACAGGAAGACGCATATGTGC
TAGCTGTC
Sequence Type mRNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59537400..59553614 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es