Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376237
Clone ID OST376237
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376237
Sequence
GGACCCTTCCTGCGCATCTCCTTCAATTCCTATGAGCTGGGCTCCCTGCAAGTTGAGGACGAAGCAAGCCAGCCTTTCTG
TGCTGTGAAGATGAAGGAGGCACTCAGCACAGAGCGAGGGAAGACACTGGTACAGAAGAAGCCCACCATGTATCCTGAGT
GGAAGACAACGTTCGACGCCCACATCTATGAAGGCCGTGTTATCCAGATTGTGCTGATGCGGNCAGNTGAAGACCCCGTG
TCTGAGGNCACGGNGGGCGNGTCAGNNCTGGCTGNGCGCTGCNNGAAGAACANCGGCNNGGCTGAGTTCTGGCTGGATCT
GCAGCCTCAGGCCAAGGCGCCTGNTGTGTGCGCAGCCTTTCCT
Sequence Type mRNA
Unitrap ID UNI19967

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31420805..31423483 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021948 (Prkcd) NM_011103 protein kinase C, delta Gene [Source:MGI (curated);Acc:Prkcd-002]

 
Come back to gene ENSMUSG00000021948


For any suggestions or comments, please send an email to unitrap@crg.es