Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376235
Clone ID OST376235
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376235
Sequence
ACGGAGGCTGGATCTGGAGACTGACCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCAG
GGAAAGGTGTGAAATCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAA
Sequence Type mRNA
Unitrap ID UNI13642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154389792..154390239 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027490 (E2f1) NM_007891 E2F transcription factor 1 Gene [Source:MGI (curated);Acc:E2f1-001]

 
Come back to gene ENSMUSG00000027490


For any suggestions or comments, please send an email to unitrap@crg.es