Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376219
Clone ID OST376219
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376219
Sequence
GACTGAGATCTGAATGAGATCGCGTTCATCAGGACTTCAGGTTTCTGACAACACTGTTTTGAGTAATGTATATATGGNCT
CTGTAATGTAGAGGNACTTCACTNNAAATGGNTCNATGACANCAAGAAACTAGGGGAATGGGTAGGCCTCTGTAAAATCN
ATCGAGAGGGCAAACCACGGAAGGTGGTTGGTTGCAGTTGCG
Sequence Type mRNA
Unitrap ID UNI2544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23505393..23706763 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061983 (AC160147.6) NM_011295 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]

 
Come back to gene ENSMUSG00000061983


For any suggestions or comments, please send an email to unitrap@crg.es