Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0666
Clone ID AW0666
Vector pGT0lxr
Project sanger

Sequence tag AW0666
Sequence
TTGTGAGCTCTTCTAGATGGGCTGAGGCCCTCAGAGAAATCTCTGGTCGCTTAGCTGAGATGCCTGCAGATAGTGGATAC
CCTGCATACCTTGGTGCCCGGCTGGCTTCTTTCTATGAGCGAGCAGGCAGAGTGAAATGTCTCGGAAACCCTGAGAGAGA
AGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGATCCAGTCACTTCTGCAACGCTGGGTA
TTGTTCAGGTGTTCTGGGGCTTGGATAAGAAGTTAGCTCAGCGCAAGCACTTCCCCTCTGTCAACTGGCTCATCAGCTAC
AGCAAGTACATGCGTGCCCTGGACGAGTACTATGACAAGCACTTCACGGAGTTTGTTCCTCTGAGGACCAAAGCTAAGGA
GATCCTGCAGGAAGAAGAGGATCTGGCAGAAATCGTGCAGCTCGTGGGAAAG
Sequence Type mRNA
Unitrap ID UNI3861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44098840..44101933 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052459 (Atp6v1a) NM_007508 ATPase, H+ transporting, lysosomal V1 subunit A Gene [Source:MGI (curated);Acc:Atp6v1a-001]

 
Come back to gene ENSMUSG00000052459


For any suggestions or comments, please send an email to unitrap@crg.es