Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST376058
Clone ID OST376058
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST376058
Sequence
TTGAGGAACGTCAGGGCTTCATGCACATGAAGCTNNCCCGGNCTAAGGAACACAAGTATGTGTTGGGCCAGAACAGCCCA
CCCTTCAGCAGCGTCCCTGAAATCGTGCACCACTATGCCAGCCGCAAGCTGCCCATTAAGGGAGCGGAACACATGTCCCT
GCTCTACCCTGTGGCCATCCGGACTCTGTAGATGTGAGACCAGGGCACTATGATAGACCTGGACCCAGTCCTTGTCACCT
GCACGGGGGCAGCAGGTTCTTACCAAGGACATGATGTCAGAAACCTGGCTTCCCCTTGTCCTAGGATCTAGCAGGCGCTG
AAGATTCCTTAATTTATTATAAAGGGGAGGGAATCCTGGGCCTTGGAATAAAGGGACTGTGTGGAGCTGGGAAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI19979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 122174890..122175277 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033256 (Shf) NM_001013829 Src homology 2 domain containing F Gene [Source:MGI (curated);Acc:Shf-001]

 
Come back to gene ENSMUSG00000033256


For any suggestions or comments, please send an email to unitrap@crg.es