Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0613
Clone ID AW0613
Vector pGT0lxr
Project sanger

Sequence tag AW0613
Sequence
GAAATTGCCCATGAGGCCCCGGGACCGGTCTCGCGTGATCGATGCTGCCAAACATGCTCACAAGTTTTGTAACACAGAAG
ATGAGGAGACTACTTATCTTCGGAGGCCTGAGGGCATTGAACGTCAGTACAGGAAGAAGTGTGCAAAGTGTGGACTGCCG
CTCTTCTACCAATCCCAGCCGAAGAATGCTCCTGTGACCTTCATTGTGGATGGAGCAGTAGTGAAATTTGGCCAAGGCTT
TGGGAAAACCAATATATATACTCAGAAACAAGAGCCTCCTAAGAAGGTTATGATGACCAAAAGGACTAAAGACATGGGCA
AGTTCAGCTCTGTTACTGTGTCTACCATTGATGAAGAAGAAGAGGAGATAGAGGCTAGGGAAGTTGCTGACTCTTACGCG
CAGAATGCCAAAGTGATTGAAAAGCAGCTGGAGCGCAAAGGCATGAGCAAGAGGAGGCTGCAGGAGTTG
Sequence Type mRNA
Unitrap ID UNI3864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34392634..34403723 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es