Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST375996
Clone ID OST375996
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST375996
Sequence
GGCTACCACAGTTGTTCAGCTCTACCTGGCACTGCCCCCTGGAGCTGAGCACTGGACCATGGAACACTGCGGGGCTGTGT
GCTTCGTGAAGGATAACCCTCAGAAGTCCTACTTCATCCGCCTTTATGGCCTACAGGCTGGTCGGCTACTCTGGGAACAG
GAGCTGTACTCTCAGCTGGTTTATCTCACGTCCCACCCCGTTCTTCCACACTTTTGCTGGAGATGACTGTCAAGNAGGAC
TGAACTTTGCGGATGAGAGTGAAGCCCAGGCCTTCCGGGCCTTGGTGCAGGAGAAGATACAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7666183..7667105 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031165 (Was) NM_009515 Wiskott-Aldrich syndrome homolog (human) Gene [Source:MGI (curated);Acc:Was-001]

 
Come back to gene ENSMUSG00000031165


For any suggestions or comments, please send an email to unitrap@crg.es