Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST375927
Clone ID OST375927
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST375927
Sequence
ACTGAGGTCCCATCTGATGCCAAGGCTGAAGGAGTCTCGGTCACACGAGTCCCTGCTCAGCCCCAGCAGCGCAGTGGAGG
CCCTGGACCTCAGCATGGAGGAGGAGGTGATTATCAAGCCCGTTCACAGCAGCATCCTGGGTCAGGACTACTGCTTCGAG
GTGACAACATCATCAGGAAGCAAGTGTTTTTCCTGCCGGTCAGCCGCTGAGCGCGATAAGTGGATGGAGAACCTGAGGCG
AGCAGTGCACCCCAACAAGGACAACAGCCGGCGTGTGGAGCATATCCTGAAGCTGTGGGTGATTGAGGCCAAGGATCTGC
CGGCCAAGAAGAAGTATCTATGTGAACTGTGCCTGGACGATGTGCTGTATGCCCGTACCACAAGCAAGCTCAAGACGGAC
AATGTCTTCTGGGGAGAGCACTTTGAGTTCCATAACCTGCCGCCTCTACGCACAGTCACTGTGCACCTGTATCGGGAGAC
TGACAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35563163..35565570 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es