Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST375873
Clone ID OST375873
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST375873
Sequence
GACTGAGTTATCAGCCAAGGTGGNTCTCAAGAGCGGCCTGGAGGAGTGTGCAGAGGCACTGAACTTATTTCTAAGTAACA
AATTTAAAGATGCCCTAGAGTTGCTACGTCCATGGGCCAAGGAGAGCATGTACCACGCCTTGGGCTACAGCACCATTGTG
GTGTTGCAGGCTGTCATGACCTTCGAGCAGCAGGACATCCAGAATGGCATCTCTGCCATGAAGGACGCTTTACAAACCTG
CCAAAAATACAGGAAGAAATGCACAGTTGTCGAGTCTTTCTCAAGTCTCCTTTCTCGAGGGTCCCTGGAACAACTGAGTG
AAGAAACTGATCTCCGAGCATCCCTAAGAACAAGAGCTGGTACTGGGAGGCCTAAAGTGTTTCCGAGACAATCCATGAGA
CTGAACTGGCCCCAGTATGACTTGCATTGCCTTTTCCTTCCTGGGAACCCCATGTGACTCCTTCCCTGGTCCATTGGTGA
CTGCTTCCCTTTTTCTTTGTGGTGTGAAGGTGACACTGGAGAGTTTTAAACCTTAGTTTTAAGAGG
Sequence Type mRNA
Unitrap ID UNI19984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82905148..82909707 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es