Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0561
Clone ID AW0561
Vector pGT0lxr
Project sanger

Sequence tag AW0561
Sequence
GCCGTGCTTTAAGAAGAGTTTAATGGGCCCGTAAGGGAGTAGGGAAGTGGCTCAGGCACAGCTGTCTGCCATGTGGGAGG
GCCTGGGTCTGATCCTCAGGATCCCTTTAACCCTCTCCCAATGAAAATAGAAGTAAGCCAGGCTGGCGGTACAAGCCTAC
AGTCTCAGCACTAAGGAACTAAACCATTAAAAAAATACAATAATCAAACTTTGTAGTTTGAACTGTTCTTCATCTCAGTT
GCTGATTTTAGAAAGTGATTGTTTTGTCTTTTAGGGAAAGGCGGAGGAGGAGGAGCAGGAGTTCTTCCAGGTCTCCAAGA
ACATCAAAGACCGTCAAAAGAAAGTCTTCTAGATCTCCGTCTCCCAGGGGCCGAAATAAGAAAGAGAAAAAGAGAGAAAA
AGAACGGGACCACATCAGTGACAGGAGAGAAAGAGAGCGTTCTACCTCCACAAAAAAGAGTTCTGGCGACCGAGACGGGA
AGGAGAAAGTGGAGAAGAGTACCACACCAGTTAAG
Sequence Type mRNA
Unitrap ID UNI3867

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 104534865..104539209 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032621 (Sfrs12) NM_172592 splicing factor, arginine/serine-rich 12 Gene [Source:MGI Symbol;Acc:MGI:2145245]

 
Come back to gene ENSMUSG00000032621


For any suggestions or comments, please send an email to unitrap@crg.es