Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST375229
Clone ID OST375229
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST375229
Sequence
CGATGGACTGTCCACTACACGGCACCATGGCATCAGCAAGAGAATGTGTTCCTTCCCGCCACAAGACCCCCCTGTGTTGA
GGACCTGCNCCGCCAAGCCAAGCTCAACCTCAAATCAGNGCTGAGGGAATGTGACAAGNTGAGGCAAGATGGCNTGCCGA
AGTTCTCAGTACTATTNTCAGGGACCCACCTTTGCAGCCGGCTCCAGCCCCTGCGACGATTATCAAGATGAANACACAGA
AGCAGACCGAAAGTGCTCTCTCTCTTCATNTGAAGAAGAAAGATTTATCGGAATNAGGAGACCTAAAACGCCAACCTGAG
GNGACTTCTCCCGACCTTCATACTCAGACNAACTGGACCAAGTNNCCTGCCGCTGCCAACACCAGAAGAGAAAAC
Sequence Type mRNA
Unitrap ID UNI15877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18192751..18231495 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]

 
Come back to gene ENSMUSG00000039835


For any suggestions or comments, please send an email to unitrap@crg.es