Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0393
Clone ID AW0393
Vector pGT0lxr
Project sanger

Sequence tag AW0393
Sequence
TTTTTTTAATTTTTTCCCCCCCCACACGTGTCTCGTTTGGTTCCACTTTTTCCGGCGGGTTTTTATTTTTTTTTTTCGGA
GTAACTGCCAAGATGGCCGAAGTGGAGCAGAAGAAGAAGCGCACCTTCTGCACAGTTCACCTGCCGTGGCGTAGACCTCG
ACCAACTGCTCGACATGTCGTATGAGCAACTGAGGCAGCTGTACAGCGCCCTCCAGAGGAGGCGCCTGAACCGTGGTATT
CGGCGGAAGCAACACTCACTGCTCAAGCGCTTGAGAAAGGCCAAAAAGGAGGCACCACCCATGGAGAAGCCTGAGGTGGT
GAAGACGCACGTGAGGGACATGATCATCTTGCCGGAGATG
Sequence Type mRNA
Unitrap ID UNI1246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79153880..79756564 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063457 (Rps15) NM_009091 ribosomal protein S15 Gene [Source:MGI (curated);Acc:Rps15-001]

 
Come back to gene ENSMUSG00000063457


For any suggestions or comments, please send an email to unitrap@crg.es