Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST375190
Clone ID OST375190
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST375190
Sequence
ACAGAATCTAAGGAAAAGCTCATTAGCCAGGCCCAGGAAGTGAGCCGACTGCGATCAGAACTGGGAGGCACGGACGCGGA
GAAGCACAGGGACAGACTGATGGTGGAGAATGAGCAGCTGAGGCAGGAGCTGAGGCGCTGTGAGGTCGAACTGCAGGAGC
TTCGGGCCCAGCCGGATGTGCCCTGCGAGGGCTGTGAGCACAGCCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97634030..97634655 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031788 (Kifc3) NP_034761 kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]

 
Come back to gene ENSMUSG00000031788


For any suggestions or comments, please send an email to unitrap@crg.es