Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST374929
Clone ID OST374929
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST374929
Sequence
CTAATATACAATGTCTAATGGNTACGAAGACCACATGGCTGGAAGACTGCAGGGATGACATTGGGAGAACGAATTTAANT
GTCAACTACCTCCCTCAGAACATGACCCAAGAGGAACTACTGAAGTCTGTTCAGCAGCATTGGCGAGGTTGAATCTGCAN
AGCTTATTCGGGATAAAGTANCAGGACACAGNTTGGGCTACGGATTTGTGAACTATGTGACTGCTAAAGATGCAGAGAGA
GCAATCAGCACACTGAACGGCTTGAGACTCCAGTCCAAAACCATTAAGGTGTCATATGCTCGCCCAAGCTCAGAGGNCAT
CAAAGATGCCAACTTATACATNAGTGGGCTCCCAAGGACCATGACACAGAAGGATGTGGAAGACATGNTTTNTNGGNTTG
GGCGAATNATCAACTCCAGGGTCCTTGAGGATCATACCACAGGT
Sequence Type mRNA
Unitrap ID UNI20019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4301683..4311775 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040028 (Elavl1) NM_010485 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene [Source:MGI Symbol;Acc:MGI:1100851]

 
Come back to gene ENSMUSG00000040028


For any suggestions or comments, please send an email to unitrap@crg.es