Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST374878
Clone ID OST374878
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST374878
Sequence
GACTGAGGATGACGTCAGTGACCAGNTCAGCAAGGTGAGTTTTACAGTGAAATTCAATGCCTCTTGCTTTGGGAATCAGG
CTCCTGAACTATCCCAGAATCCTCCTTGGCTCCTGGTGCCTTTGGAATCACACCGTGTGTGGGTTTACAAAAAGGCCTTC
TCTAGGTTTCCATCACCAGGGAAATAGGTTTCCCTCCGTCCTCCTTCCCTTCTGCCTAGGCTCCTAGGAAGCTGGTCCTT
CAACTGTATACCATCTTATATATTAAAGTTGCTGCAGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20021

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156831335..156831611 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027635 (Dsn1) NM_025853 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dsn1-002]

 
Come back to gene ENSMUSG00000027635


For any suggestions or comments, please send an email to unitrap@crg.es