Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0305
Clone ID AW0305
Vector pGT0lxr
Project sanger

Sequence tag AW0305
Sequence
CCACAGTGCTGATGACAAAGAGCAAGTTGTAATCCGCAGCACTGCCAGGGCTGAGCCGGGCAGACAGAAAATCGTCATTT
GCTGCTCACAGGCTTGTTAGGTTACAGCCTCTGCTTCGTTCTGTGGTCTTGGCTTTTCTTCCTATACAATGACGGCGCTG
CAAGTGAGCTCAGAAATGCTTGGTTTGAAAGCCATTTGCCTGTGATTGTTTTTGAAGACTAAAGAAGTATTTATGCTCGA
TTAAAAAAATACTGCTCACGAACAAAATGAAATGCCAGCTATATTTACTGACCTTTAAAGCCTTGGCTTGGATTGCTGAG
ATTTAAAGATACTTTAAAATTCTCAAGAACTAAGTACGACTTTCAAACCATTGGTTTAAAATAGTATACCTAGTTCTATC
ACTGCAGTAGAATTCTTTATAGATAAGCAACTGGATTTTTTAACAGAAGATAGTGCCTTTCAGCCATACCAG
Sequence Type mRNA
Unitrap ID UNI569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66648702..66652597 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es