Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST374365
Clone ID OST374365
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST374365
Sequence
GAACTGAGACTTGAGTAAATCTATGTCAGGGNAGGCAGAAGCTCGAAGCACAGCTAACGGAAAACAATATCGTGAAGGAG
GAGCTGGCCCTGCTGGATGGATCCAACGTGGTCTTTAAGCTTCTGGGACCCGTGCTTGTCAAACAGGAGCTGGGGGAGGC
TCGGGCCACAGTAGGGAAGAGGCTAGACTACATCACAGCAGAAATCAAGCGCTACGAATCACAGCTTCGGGACCTCGAGC
GGCAGTCAGAGCAACAGAGGGAAACCCTTGCTCAACTGCAGCAGGAGTTTCAGCGGGCCCAAGCTGCAAAGGCTCCTGGG
AAAGCCTGACCCCGTGGGAGGGGGTCAGGAGGAAGGGATGAGGCTAACCCTGAGCCAATAAAATGTAAACAGAACCAAAA
AAAAA
Sequence Type mRNA
Unitrap ID UNI20044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34075864..34076765 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024309 (H2-Ke2) NM_010385 H2-K region expressed gene 2 Gene [Source:MGI Symbol;Acc:MGI:95908]

 
Come back to gene ENSMUSG00000024309


For any suggestions or comments, please send an email to unitrap@crg.es