Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST374337
Clone ID OST374337
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST374337
Sequence
AGAGAAATAATTCCAGATTGATGGATGAAATTTTAAAACAGCAACAGGAACTTTTGGGCCAAGATTGTTCCAAATACTCA
GCAGAGTTTGCAAATAGTAATGACAAAGACGATCAAGATTTAAATTGCCCTTCGGCAGTGAAGGTGCTGTCCCCAGAAGA
TGGAAAAGCGGATATTGTGAGAGCTGCCCAGGATTTTTGCCAGTTAGTAGCCCAGCAGCAGAGGAAGCCCACAGATCTGG
ATGTAGATCTGCTAGGCAGCTTACTTAGTTCACATGGGTTCCCTGATCCTGACTTAGTGTTGAAGTTTGGTCCTGTGGAC
AGCACATTAGGCTTTCTTCCCTGGCAAATCAGATTGACTGAGATCGTCTCTCTGCCTTCTCACCTAAACATCAGCTATGA
GGACTTCTTCTCCGCCCTTCGGCAGTATGCAGCTTGCGAACAGCGACTGGGAAAGTAATGGTCCCTACTTGCATAATTTG
ACTTCAGGCTTTTGGAGAAAA
Sequence Type mRNA
Unitrap ID UNI20047

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 52149008..52156516 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023068 (Nus1) NM_030250 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1196365]

 
Come back to gene ENSMUSG00000023068


For any suggestions or comments, please send an email to unitrap@crg.es