Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0173
Clone ID AW0173
Vector pGT0lxr
Project sanger

Sequence tag AW0173
Sequence
TTTTAAAGGGGTTTTTTTTTTTTTCCTACCCTATGTTTTGTTCGTTTTCTTTGTAGTGCATTCATAAGCACCTTCAATAA
CAACTATTCAGCCATCTCAGGAATAAATCTGAAAATCCCATGGTGCAGCTATTCTACGGTACTTTTCTGACAGAAGGGGT
CCGAGAAGGAAAGCCCTTTTGTAACAATGAGACCTTCGGCCAGTATCCTCTTCAGGTAAACGGTTACCACAACTTAGACG
AATGTTTGGAAGGGGCCATGGTGGAAGGTGACATCGCGCTGCTTCCTTCGGATCGTTCCGTGAAGTATGGGCTGGTGGTG
GCCTTTTCCACGAAAGGCTTTTTTTTTTTTTTTTTT
Sequence Type mRNA
Unitrap ID UNI3886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48819368..48823357 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es