Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST374110
Clone ID OST374110
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST374110
Sequence
GAGGACCCCTTCCTGATGGATGGGAGCAAGCCATGACTCAGGATGGAGAAGTTTACTACATAAACCATAAGAACAAGACC
ACATCCTGGCTGGACCCAAGGCTGGACCCTCGTTTTGCCATGAACCAGAGGATCACTCAGAGTGCTCCAGTGAAGCAGCC
CCCACCCTTGGCTCCCCAGAGCCCACAGGGAGGCGTCCTGGGTGGAGGCAGTTCCAACCAGCAGCAGCAAATACAGCTGC
AGCAGTTACAGATGGAGAAGGAGAGACTGCGGTTGAAACAACAGGAATTATTTCGGCAGGCAATACGGAATATCAATCCC
AGCACAGCAAATGCTCCAAAATGTCAGGAATTAGCTCTGCGCAGCCAGTTGCCTACACTGGAGCAGGATGGAGGGACTCC
GAATGCAGTGTCTTCTCCTGGGATGTCTCAGGAATTGAGAACAATGACAGCCAATAGTTCCGATCCCTTTCTTAACAGNG
GCACCTATCACTCTCGAGATGAGAGCACAGACAGCGGCCCTCAGCATGAGCA
Sequence Type mRNA
Unitrap ID UNI68

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7936575..7962404 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]

 
Come back to gene ENSMUSG00000053110


For any suggestions or comments, please send an email to unitrap@crg.es