Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST374062
Clone ID OST374062
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST374062
Sequence
ACAGTGTAGACGGGCGCCCCCGGTGTTGTCTCAGTCACGCGTCACAAGTCGCCTGCAGCTGCCCGAAGAGCCAAGAGTCA
GTATTCCGGCCAGCTTCACGAAGTCAGAGAGATGATGAACCAGGTGGAAGGCCAGCAGAAGAACCTCGTGCATGCCATTG
AGTCCCTGCCAGGCTCGGGCCCCCTCACTGCCTTGGACCAGGACCTGCTTCTCCTGAAGGCTACCTCTGCCGCCACCCTC
AGCTGTCTTGGGGAGTGCCTCAGCCTGCTTCAGCAGAGTGTGCGCCAGGCAGCGCCACCCAGCCACAAGCCAGGCGCCTC
AGAGACCATCCTGGGATGGCATGGGCCCACGTCACATTCCACAGACCAACTGAAAAATGGGACCCTCGGCTCTCTACCCT
CCGCCAGTGCCAACATA
Sequence Type mRNA
Unitrap ID UNI20064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 115018608..115085140 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040875 (Osbpl10) NM_148958 oxysterol binding protein-like 10 Gene [Source:MGI Symbol;Acc:MGI:1921736]

 
Come back to gene ENSMUSG00000040875


For any suggestions or comments, please send an email to unitrap@crg.es