Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST373916
Clone ID OST373916
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST373916
Sequence
TGAGATCCAGACGCGGAAGTGTGTCTTCATACCCTGCGGCTCATCCAGTCTGTGGTTCTAGAACCAGACGTCTTCTCCAA
GGTGGCCTCTGAGCTCCAGAGCTCCTTACCCTTGCAGCGCATCCTGGCCATGTCCAAGAGCCGCAACTCCCACCTGCAGT
CTGCTGCCCAGGAGCTCCTGGAAGACCTCCGCGCCCTGGACTGTAATGTTTAGATGTGCTCTACCACCAGGAGCCCGGTG
AAAATGCCAGTGGTCCATCCCCTCCCAGGCTTCTAACTCCATGTTCAAAACTAGATGTCACTGTATGTCATGTGTTAGAG
ATTGCAGGCCTTGAGGGACTAGAGATGGACATGATGGGTCAGCATCCTACCTCTTCCTCCTGGGAGTGCACACTTGTTAG
GCAGCTGGTTAATCTTGCCAGAGCAGTGACCAAAAAAATGTCACCTTTGAATGCATGGAAACTCTCAAAGTGTTTTCTCA
GAGTAGCTTCTTGCTGCCCCGGAGGCTGCCTTGCAGCATGGGAGTTTAGATCACT
Sequence Type mRNA
Unitrap ID UNI17331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32083227..32083758 529
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002076 (Hsf2bp) heat shock transcription factor 2 binding protein Gene [Source:MGI (curated);Acc:Hsf2bp-001]

 
Come back to gene ENSMUSG00000002076


For any suggestions or comments, please send an email to unitrap@crg.es