Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST373852
Clone ID OST373852
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST373852
Sequence
ACTGAGTTCCCGACGAGCTTCTCTTATCGCTGGAGTTTGTGTTTGGGTCATCGGCCATCCAGGCCTTGGACCTAGTCGAT
CGAGAGTCCGTCACTTTAATCTCATCACCCAGTGGAAGGCGTGTTTACCAGGTGCTAGGGAGTTCTGGCAAAACATATAC
ATGTCTGGCTTCCTGTCATTACTGCTCGTGCCCAGCATTCTCCTTCTCAGTGTTACGGAAGAGTGACAGCCTGCTGTGTA
AGCATCTTCTGGCAATTTACCTTAGTCAGCTTCTGAGGAACTGCCAGCAGCTCCATGTGTCTGACAAGCAACTGACAGAC
CTATTGATGGAGGACACAAGAAGGATAAAAGGTGCGGCTGGAACATGGACTTCAAAGACAGAAGCCTAGCAGGAAACGCA
TTCACATCTCACGGTGCCCGAGGTGGAGGAATGGGATGCACTTCCAGACTTGTGACTGTCACTTCACCCTCACAGGCTAG
GCTGCAGAGGGTCTGTGTGGTTAAGAGCCCTCTATGGTCTTAATATTAGCCAGCCTCTGAGCCGGC
Sequence Type mRNA
Unitrap ID UNI3041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62080802..62090143 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014243 (2410012H22Rik) zinc finger, SWIM-type containing 7 Gene [Source:MGI Symbol;Acc:MGI:1916997]

 
Come back to gene ENSMUSG00000014243


For any suggestions or comments, please send an email to unitrap@crg.es