Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0092
Clone ID AW0092
Vector pGT0lxr
Project sanger

Sequence tag AW0092
Sequence
GGAGCCTCATTCCTCAGGAACAAGGGTCGGGTGTCGAGGAGACCATTTCACACCAGCTCCCGTTCCCCGCCTCCGGGTAA
CTATGTCCTGGACCGAGATGAGCTGGTGGATGCCCAAAGACCGGAGTAGGATGAGGAGCTGTGCTTCAGCCTCACCAAGT
GGGTGCACTAGAAGTGGGGTGATGAGTGGCTGAAGAGAATGTTCCGCCTCATTTACTTGGGCGGTGCGCCCTGGGGGATT
CTGGTCCTGGAGCCCCAACCATGGTCCTCCTACTGCAAGAGAAAGTGTCTCACGGTCC
Sequence Type mRNA
Unitrap ID UNI3893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138224356..138227896 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029726 (Mepce) NM_144913 methylphosphate capping enzyme Gene [Source:MGI (curated);Acc:Mepce-001]

 
Come back to gene ENSMUSG00000029726


For any suggestions or comments, please send an email to unitrap@crg.es