Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0070
Clone ID AW0070
Vector pGT0lxr
Project sanger

Sequence tag AW0070
Sequence
TTTTTTTATTATTGTCTGCAACATGGCGGCGTCCGGTTGAAAGGGTGTCAGAGCATAGGTGGTCAGGCTGCACCGGGGAA
GGCTGGCGATTGACAAAGCAGCTGGGAGGTGAACATTTCTGGTGAGGAGAGAGAAAAGTGTACGCCACAAGATTGTTTCT
TGGTTTTGTCTGCAACATGGCGGCGTCCGGTTGAATTGGGTGTCAGAGCATAGGTGGTCAGGCTGCACGGGGGAAGGCTG
GCGATTGACAAAGCAGCTGGGAGGTGAACATTTCAGTATTACTATGAATATCAATCATAAAGGTGTTTTGAAACTCACTA
AAATGGAAAAGAAGTTCTTAAGGAAACAGAGTAAAGCCAGGCATGTGTTGCTGAAACATGAAGGCATCCAAGCAGTGTCT
TATCCCACTCAG
Sequence Type mRNA
Unitrap ID UNI3898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3335480..3338591 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]

 
Come back to gene ENSMUSG00000025899


For any suggestions or comments, please send an email to unitrap@crg.es